What is the function of the release factor during translation in Eukaryotes?
It binds to the stop codon in the A site in place of tRNA
Which of the following processes occurs in eukaryptic gene expression?
A cap is added to the 5’ end of the mRNA
Which of the following molecules is a protein produced by a regulatory gene?
repressor
In eukaryotes, there are several different types of RNA polymerase. Which type is involved in transcription of mRNA for a goblin protein?
RNA polymerase II
Which of the following functions are characteristic of general transcription factors in eukaryotes?
They bind to other proteins or to the TATA box
refer to the metabolic pathway pictured on the actual practice test. If A,B, and C are all required for growth, a strain that is mutant for the gene-encoding enzyme A would be able to grow on medium supplemented with which of the following nutrients?
either nutrient B or C
An original section of DNA has the base sequence AGCGTTACCGT. A mutation in this DNA strand results in the base sequence AGGCGTTACCGT. What type of mutation does this change represent?
Frameshift mutation
In Drosophila melanogaster, vestigial wings are determined by a recessive allele of a gene that is 8) linked to a gene with a recessive allele that determines black body color. T. H. Morgan crossed black-bodied, normal-winged females and gray-bodied, vestigial-winged males. The F1 were all
gray bodied, normal winged. The F1 females were crossed to homozygous recessive males to
produce testcross progeny. Morgan calculated the map distance to be 17 map units. Which of the following information is correct about the testcross progeny?
gray-bodied, normal-winged flies plus black-bodied, vestigial-winged flies = 17% of the
total
One possible result of chromosomal breakage is for a fragment to join a nonhomologous chromosome. What is this type of chromosomal alteration called?
Translocation
Which of the following statements best describes the termination of transcription in prokaryotes?
RNA polymerase transcribes through the terminator signals (Rho-dependent or Rho-independent), causing the polymerase to separate from the DNA and release the transcript.
Under what conditions does the trp repressor block transcription of the trp operon?
when the repressor binds to tryptophen
From left to right, human check cells, human nerve cells, human red bloods cells. Why do these three cells, taken from the same human, have different functions?
They have differential gene expression patterns
Which of the following processes occur when termination of translation takes place?
A stop codon is reached
The purpose of the spliceosome is to:
remove introns from the premature mRNA
refer to picture on actual practice exam. Which of the following sequences of nucleotides are possible in the template strand of DNA that would code for the polypeptide sequence Phe-Leu-Ile-Val?
3’-AAA-GAA-TAA-CAA-5’
Refer to the picture from the question above. Which of the triplets below is a possible anticodon for tRNA that transports proline to a ribosome?
3’-GGC-5’
Below are the mature mRNA sequences of two strains of a virus: one is a normal strain and the 17)
other is a mutated strain.
Normal strain RNA: 5’ UAACCAUGAUCAUUGCUUUGAGCUACAUUUAA 3’ Mutated strain RNA: 5’ UAACCAUGAUCAUUGCUUAGAGCUACAUUUAA 3’
How many amino acids (in total ) is translated in the normal and mutated strain, respectively? Also, what kind of mutation is this? Refer to the codon table when answering this question.
8 and 4; nonsense mutation
DNA methylation and histone acetylation are examples of which of the following processes?
epigenetic phenomena
refer to picture on actual practice exam. What type of nondisjunction is seen in this human karyotype and what is the chromosomal sex of this person?
extra somatic chromosme, female
Use this model of a eukaryotic transcript to answer the following question.
E = exon and I = intron
5’-UTR E1 I1 E2 I2 E3 I3 E4 UTR-3’
Which components of the previous molecule will also be found in mRNA in the cytosol?
5’-UTR E1 E2 E3 E4 UTR-3’
The cAMP receptor protein (CRP) is said to be reponsible for positive regulation of the lac operon because____
CRP bound to the CRP-binding site stimulates the transcription of the lac operon
The genetic code is essentially the same for all organisms. From this, one can logically assume which of the following statements to be true?
A gene from an organism can theoretically be expressed by any other organism
If cell x enters meiosis, and nondisjunction of one chromosome occurs in one of its daughter cells during meiosis II, how will this affect the gametes at the completion of meiosis?
one-quarter of the gametes descended from cell x will be n + 1, one-quarter will be n - 1, and half will be n
refer to the picture in the actual practice exam. In a series of mapping experiments, the recombination frequencies for four different linked genes of Drosophila were determined as shown in the figure. Based on this information, what is the order of these genes on a chromosome map?
b-rb-cn-vg