EXAM 1

Question 1

There are two reasons why the original classification for Reptilia was paraphyletic. Select both reasons

Answer 1

Many of the lineages with intermediate physical characteristics linking birds and other reptiles are extinct

Physically birds look very different than other members of this group

Question 2

What is a “hard polytomy” and how might it be resolved?

Answer 2

When three or more lineages diverge simultaneously from a common ancestor. It cannot be resolved as the polytomy is the best way to depict the actual evolutionary events.

Question 3

If I have a data set composed of 50 different species I couldn’t evaluate every possible phylogeny. Why not?

Answer 3

There are too many possible phylogenies, even the fastest super computers couldn’t evaluate everyone in a finite amount of time.

Question 4

Only monophyletic and polyphyletic classifications are valid.

Answer 4

FALSE

Question 5

The basic principle of parsimony is that __________.

Answer 5

the simplest explanation is most often the best explanation

Question 6

what is homology?

Answer 6

similarity of features due to inhertance form a CA

Question 7

what are synamoprhies?

Answer 7

most valid monophyletic clades have homologous traits (synamoprhies) that are defining characteristics of the group

examples; mammal birds

Question 8

how do we estblish homology?

Answer 8

1. morpholigcal position
2. assessment of overall similarity

Question 9

what are the causes of homoplasy?

Answer 9

1. convergence
2. symplesiomoprhy

Question 10

gene

Answer 10

piece of dna transcribed into rna

Question 11

point mutations

Answer 11

1. Substitution - one piece of dna is copied incorrectly.
2. insertion/deletion

Question 12

silent mutations

Answer 12

have no impact on phenotype

Question 13

synonymous mutations

Answer 13

mutation in the coding regions that don’t change the protein coding sequence

Question 14

large mutations

Answer 14

1. duplications
2. deletion
3. inversion
4. translocation

Question 15

What effect does a mutation have on a phenotype? (not a fair question..dr terry’s words)

Answer 15

it varies?

Question 16

homology

Answer 16

similarity of features due to inheritance from a common ancestor

Question 17

synapomorphy

Answer 17

homology that occurred in an ancient ancestor and all of the descendants still have it

Question 18

monphyletic clades

Answer 18

a group of organisms that includes a single common ancestor and all of its descendants

Question 19

how do we establish homology?

Answer 19

1. morphological position
2. Assessment of overall similarity
3. map it on a phylogeny

Question 20

convergence

Answer 20

the process where distantly related organisms independently develop similar traits or features, such as body shapes or functions, due to similar environmental pressures or ecological niches.

Question 21

Homoplasy

Answer 21

describes similarities in traits or features between unrelated species that arise independently, rather than from a shared common ancestor.

Question 22

what are the two causes of homoplasy?

Answer 22

• convergence
• symplesiomorphy

Question 23

symplesiomorphy

Answer 23

a shared, ancestral character state present in two or more lineages that were inherited from a common ancestor, but it is not unique to that particular clade and predates its last common ancestor.

Question 24

are the bird and bat wing homologous?

Answer 24

yes / no

both have the ability to fly, similar bone structure ,

Question 25

lysozyme example,

Answer 25

cows have a lyzozyme enzyme, some primates have the same enzyme are they homologous? yes/no

Question 26

what does an alignment represent?

Answer 26

homology

Question 27

orthology

Answer 27

genes in different species that are derived from a single ancestral gene through speciation, and they typically retain the same function over evolutionary time.

Question 28

Paraology

Answer 28

the evolutionary relationship between genes or proteins that arose from a single ancestral gene through gene duplication. These resulting paralogous genes can then diverge, potentially leading to new or modified functions within the same species or across different species.

Question 29

Orthology vs Paralogy

Answer 29

Unlike orthologs, which are separated by a speciation event, paralogs are separated by a duplication event.

Question 30

paraphyletic

Answer 30

(of a group of organisms) descended from a common evolutionary ancestor or ancestral group, but not including all the descendant groups.

Question 31

polyphyletic

Answer 31

(of a group of organisms) derived from more than one common evolutionary ancestor or ancestral group and therefore not suitable for placing in the same taxon.

Question 32

By reference to the phylogeny below, which of the following is an accurate statement of relationships? {google docs image} A seal is equally related to a horse and a whale Incorrect ResponseSelected A seal is more closely related to a whale than to a horse Unselected A seal is related to a whale, but is not related to a horse Unselected A seal is more closely related to a horse than to a whale

Answer 32

A seal is equally related to a horse and a whale Explination: their branches diverge from the same ancestral node, meaning they share a common ancestor with each at the same point in evolutionary history

Question 33

Which of the following statements is the best definition for a gene? A gene is a portion of DNA that helps to regulate transcription and translation. A gene is a piece of DNA that corresponds to an amino acid sequence in a functional protein. A gene is a section of DNA that is different from any other section and can be mapped to a specific locus. A gene is a section of DNA that is transcribed into an RNA product.

Answer 33

A gene is a section of DNA that is transcribed into an RNA product.

Question 34

The impact of a mutation depends on where it is located in the genome and the type of mutation. True or Flase?

Answer 34

True

Question 35

Select the best follow-up statement: A shark's dorsal fin and an orca's dorsal fin are homologous structures. True, because they are both in the same position and have a similar function. False, because when you map the origin of these structures onto a well-supported phylogeny they are clearly convergent and don't connect to a common ancestral feature. True, because developmentally they are made from the same type of tissue False, because developmentally they are made from different types of tissue

Answer 35

False, because when you map the origin of these structures onto a well-supported phylogeny they are clearly convergent and don't connect to a common ancestral feature.

Question 36

All living species share a common ancestor

Answer 36

True

Question 37

There are two reasons why the original classification for Reptilia was paraphyletic. Select both reasons Many of the lineages with intermediate physical characteristics linking birds and other reptiles are extinct Because of massive convergence of physical characteristics among the lizards and the crocodilians. Genome duplication among the Squamata made it difficult to identify their closest relatives. Physically birds look very different than other members of this group.

Answer 37

Many of the lineages with intermediate physical characteristics linking birds and other reptiles are extinct Physically birds look very different than other members of this group.

Question 38

Praphyletic

Answer 38

In biology, paraphyletic describes a group of organisms that includes a common ancestor but not all of its descendants Includes a common ancestor: The group originates from a single ancestral species.

Question 39

If I have a data set composed of 50 different species, I couldn't evaluate every possible phylogeny. Why not?

Answer 39

There are too many possible phylogenies, even the fastest supercomputers couldn't evaluate everyone in a finite amount of time.

Question 40

What is a "hard polytomy" and how might it be resolved?

Answer 40

When three or more lineages diverge simultaneously from a common ancestor. it cannot be resolved as the polytomy is the best way to depict the actual evolutionary events

Question 41

only monophyletic and polyphyletic classifications are valid

Answer 41

false

Question 42

basic principle of parsimony is that

Answer 42

the simple explanation is most often the best explanation

Question 43

whihc of the following methods of estimating a phylogeny uses distance data and an optimization algorithm?

Answer 43

minimum evolution

Question 44

The following piece of DNA comes from what species? (hint: https://blast.ncbi.nlm.nih.gov) ATGAGAAAAATGTCAGAGGAAGAGTTTTATCTGTTCAAAAATATCTCTCCGGTGGGGCCGTGGGATGGGCCTCAGTACCACATTGCCCCTGTCTGGGCCTTCTACCTCCAGGCAGCTTTCATGGGCACTGTCTTCCTTATAGGGTTCCCACTCAATGCCATGGTGCTGGTGGCCACACTGCGCTACAAAAAGTTGCGGCAGCCCCTCAACTACATTCTGGTCAACGTGTCCTTCGGAGGCTTCCTCCTCTGCATCTTCTCTGTCTTCCCTGTCTTCGTCGCCAGCTGTAACGGATACTTCGTCTTCGGTCGCCATGTTTGTGCTTTGGAGGGCTTCCTGGGCACTGTAGCAGGTCTGGTTACAGGCTGGTCACTGGCCTTCCTGGCCTTTGAGCGCTACATTGTCATCTGTAAGCCCTTCGGCAACTTCCGCTTCAGCTCCAAGCATGCACTGACGGTGGTCCTGGCTACCTGGACCATTGGTATTGGCGTCTCCATCCCACCCTTCTTTGGCTGGAGCCGGTTCATCCCTGAGGGCCTGCAGTGTTCCTGTGGCCCTGACTGGTACACCGTGGGCACCAAATACCGCAGCGAGTCCTATACGTGGTTCCTCTTCAT

Answer 44

gorilla gorrila

Question 45

from what geen is teh dna in question above? {no picture quiz questions}

Answer 45

Opsin

Question 46

the character below is mapped onto the phylogeny as a convergent mutation in two different lineages. Which of the following is the most correct statement?

Answer 46

in a strict parsimony analysis (all changes weighted equally) it could also be mapped as a symplesimorphy

Question 47

Which of the following observations would be most impactful when considering whether you want to use a weighted parisomy approach?

Answer 47

Some types of mutations happen much more frequently than others

Question 48

even the largest data sets use the best techniques, are not gauranteed to result in the ture phylogency for ancient relationships of living organims

Answer 48

true

Question 49

Which of the following is the best reason why someone might not use an optimization method to estimate phylogenetic relationships

Answer 49

optimization methods can be very inefficient (they take a lot of time and resources)

Question 49

what is weighted parsimony?

Answer 49

method that choses the simplest explanation from multiple options by assigning differetn costs, or weights, to differetn evolutionary changed rather than assuming all changes are equally likely.

Question 50

what best describes the final result of a Bayesian analysis and how it is represented in a phylogeny

Answer 50

a phylogeny that is not very accurate but is a good inital estimate of relationships among species.

Question 51

What best describes the advantage of a Bayesian analysis compared to a maximum likelihood analysis?

Answer 51

Bayesian analysis incorporates models of evolution in a statistical framework, but more efficient than maximum likelihood methods

Question 52

of all the methods of phylogenetic inference discussed in class,s which is the most efficient

Answer 52

neighbor joining