Describe covalent, ionic, and hydrogen bonds and give an example of each.
- Hydrogen bond- water; electropositive bond with electronegative oxygen; not a true bond
- Covalent bond- carbon dioxide; electrons are shared equally
- Ionic bond- Salt; na loses an electron, Cl gains and because opposite charges they attract
If a sequence of DNA is 5’ TACGCCTAGCGATCGGCTATC 3’ what would the corresponding mRNA and tRNA sequence be?
- mRNA: UAC GCC UAG CGA UCG GCU AUC
- tRNA: AUG CGG AUC GCU AGC CGA UAG
Describe hypotonic, hypertonic, and isotonic solutions as it applies to cells. What woud happen to a red blood cell place in each type of solution?
- Hypotonic- the RBC would swell because water is rushing into the cell in order to equalize solute content
- Isotonic- the RBC remains normal because the solute concentration is relatively equal
- Hypertonic- RBC would shrivel up because the cell would force water out to equalize the solute concentration
Name and describe three factors that affect chemical reaction rates.
- Temperature increase- causes an increase in rates
- Concentration increase- causes an increase in rates
- Particle size decrease - causes an increase in rates
Describe how the sodium-potassium pump works. Why is it so vital to cells?
The pump works against sodium and potassium gradients in order to maintain balance between the intracellular potassium and the extra sodium. It is important to cells becasue of the electrochemical gradient is cruical for the nerves and muscles. It also helps maintain fluid volume.
List all of the stages of the cell cycle and briefly describe what happens in each.
- Interphase- cell growth and developement
- Prophase- nuclear envelope fragments, chromosome move towar the middle, microtubles form
- Metaphase- chromosome line up in the middle
- Anaphase- chromotid seperate, motor proteins pull them towards opposite poles
- Telophase- opposite of phrophase, nucleus reappears, chromatin uncoil, microtubles dissappear, nucleoi appear
- Cytokinesis- cytoplasm seperates at the cleavae furrow
Name the three types of cartilage and tell me where each can be found.
- Elastic- external part of the ear
- Hyaline- nasal cavity
- Fibrocaritlage- in the meniscus
Distinguish between the three types of muscle tissue.
- Skeletal- strations, long with multiple nucli
- Caridac- strations, branched, one nucleus, interclated discs
- Smooth- spindle-shaped, no striations, arranged in sheets
What are the three classifications of burns and some characteristics of each?
- 1st degree-edema, redness, pain, epidermis only
- 2nd degree- blisters, pain, epidermis and upper part of the dermis
- 3rd degree- no skin left, no pain, black, eposed to infection
What is ABCD rule and what is it used for?
Signs to look for when skin cancer is a possibility for a mole:
- Asymmetry
- Border irregularity
- Color
- Diameter
Describe a functional unit of bone including the structures found in it.
Osteon is the basic structural unit of compact bone.
- Central canal- longitudinal opening that conatin vessels and nerves
- Lamellae- rings that radiate from central canal
- Lacunae- small pockets that are on the lamellae and holds osteocytes
- Canaliculi radiates from lacuena;communicates between osteocytes and material matrix
Name and give the description for five bone markings.
- Groove- furrow
- Head- bone projection from narrow neck
- Line- narrow ridge of bone (less prominent)
- Crest- narrow ridge of bone (more prominent)
- Fissure- slit-like opening
Describe four of the six structural types of synovial joints and give an example of each
- reinforcement ligaments
- ACL
- articular cartilage
- Menisci
- synovial fluid
- the fluid in the bursae around the knee
- synovial cavity
- the bursae around the knee
Describe two of the types of inflammatory or degenerative conditions that affect joints.
- Lyme disease
- caused by bacteria transmitted by a tick
- may lead to joint pain and arthritis
- Osteoarthritis
- cartilage is destroyed faster than replaced by an over used joint
Describe what happens when someone recieves a lateral blow to an extended knee (common among football players).
The ACL, TCL, and medial meniscus are torn.
What are the functions of calcium in skeletal muscle contractions?
- assists in the release of Ach
- control the regulating protein trophin and tromyosin actin
Describe each of the three types of skeletal muscle fibers. What types are more abundant in marathon runners vs. bodybuilders?
- Slow oxidative
- red
- small diameter
- many caparillies and mitochrondria
- found in long distant runners
- fast oxidative
- redish- pink
- intermediate diameter
- many caparillaries and mitochrondria
- found in runners
- fast glycolitic
- pale white
- large diameter
- few caparilleries and mitochrondria
- found in bodybuilders
Describe the different energy systesm used during sports and exercise. (tell me when each pathway would be used).
- Muscles use ATP
- from start to 10s mark
- Muscle use aerobic endurance
- from 10s to 30min
- Muscles run on anaerobic
- from 30min to the hour mark
- Anaerobic thresold is at the hour mark
- Muscles run on glycolysis
- from 1hr mark to the end of exercise
Name all the layers of skin (including the one found in thick skin) from the bottom to the top and give the function of each.
Stratum Corenum
- protective layer of 40 cells
- protectives against penetration/abrusion
Stratum lucidum
- clear layer of dead cells that allows skin to stetch
Stratum grannulosum
- where keritinazation/production occurs
Stratum spinosum
- gives strength and flexibility
Stratum basale
- actively dividing cells that replace all other layers
Dermis
- gives strength and flexiability and blood supplyto epidermis
Hypodermis
- holds fat and water and connects to the underlying tissues
What is Wolff’s Law and what does it explain?
Wolff’s law defines how bones grow and rebuild. The law states that the bones will grow and remodel in order to meet the demands placed on it. This law explain why the bone density in a dominant arm or leg is greater than the other arm.
What are the distinguishing features of synovial joints?
- blood vessels and nerves
- reinforcement ligaments
- synovial fluid
- synovial cavity
- fibrous capsule
- articular capulse
- articular cartilage
